Skip to main content
Advertisement
  • Neurology.org
  • Journals
    • Neurology
    • Clinical Practice
    • Genetics
    • Neuroimmunology & Neuroinflammation
    • Education
  • Online Sections
    • COVID-19
    • Inclusion, Diversity, Equity, Anti-racism, & Social Justice (IDEAS)
    • Innovations in Care Delivery
    • Practice Buzz
    • Practice Current
    • Residents & Fellows
    • Without Borders
  • Collections
    • Topics A-Z
    • Disputes & Debates
    • Health Disparities
    • Infographics
    • Null Hypothesis
    • Patient Pages
    • Translations
  • Podcast
  • CME
  • About
    • About the Journals
    • Contact Us
    • Editorial Board
  • Authors
    • Submit a Manuscript
    • Author Center

Advanced Search

Main menu

  • Neurology.org
  • Journals
    • Neurology
    • Clinical Practice
    • Genetics
    • Neuroimmunology & Neuroinflammation
    • Education
  • Online Sections
    • COVID-19
    • Inclusion, Diversity, Equity, Anti-racism, & Social Justice (IDEAS)
    • Innovations in Care Delivery
    • Practice Buzz
    • Practice Current
    • Residents & Fellows
    • Without Borders
  • Collections
    • Topics A-Z
    • Disputes & Debates
    • Health Disparities
    • Infographics
    • Null Hypothesis
    • Patient Pages
    • Translations
  • Podcast
  • CME
  • About
    • About the Journals
    • Contact Us
    • Editorial Board
  • Authors
    • Submit a Manuscript
    • Author Center
  • Home
  • Articles
  • Issues

User menu

  • My Alerts
  • Log in

Search

  • Advanced search
Neurology Genetics
Home
A peer-reviewed clinical and translational neurology open access journal
  • My Alerts
  • Log in
Site Logo
  • Home
  • Articles
  • Issues

Share

April 2021; 7 (2) ArticleOpen Access

Biallelic DAB1 Variants Are Associated With Mild Lissencephaly and Cerebellar Hypoplasia

Daphne J. Smits, Rachel Schot, Martina Wilke, Marjon van Slegtenhorst, Marie Claire Y. de Wit, Marjolein H.G. Dremmen, William B. Dobyns, A. James Barkovich, Grazia M.S. Mancini
First published January 21, 2021, DOI: https://doi.org/10.1212/NXG.0000000000000558
Daphne J. Smits
From the Department of Clinical Genetics (D.J.S., R.S., M.W., M.S., G.M.S.M.), ErasmusMC University Medical Center Rotterdam; Department of Child Neurology (M.C.Y.W.) and Department of Radiology (M.H.G.D.), Sophia Children's Hospital, ErasmusMC University Medical Center Rotterdam, the Netherlands; Department of Pediatrics (W.B.D.), University of Washington; Department of Neurology (W.B.D.), University of Washington, Seattle; Center for Integrative Brain Research (W.B.D.), Seattle Children's Research Institute, WA; Department of Human Genetics (W.B.D.), University of Minnesota, Minneapolis; Department of Radiology and Biomedical Imaging (A.J.B.), University of California, San Francisco; and ENCORE Expertise Center for Neurodevelopmental Disorders (M.C.Y.W., M.H.G.D., G.M.S.M.), ErasmusMC University Medical Center, Rotterdam, the Netherlands.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • For correspondence: d.smits@erasmusmc.nl
Rachel Schot
From the Department of Clinical Genetics (D.J.S., R.S., M.W., M.S., G.M.S.M.), ErasmusMC University Medical Center Rotterdam; Department of Child Neurology (M.C.Y.W.) and Department of Radiology (M.H.G.D.), Sophia Children's Hospital, ErasmusMC University Medical Center Rotterdam, the Netherlands; Department of Pediatrics (W.B.D.), University of Washington; Department of Neurology (W.B.D.), University of Washington, Seattle; Center for Integrative Brain Research (W.B.D.), Seattle Children's Research Institute, WA; Department of Human Genetics (W.B.D.), University of Minnesota, Minneapolis; Department of Radiology and Biomedical Imaging (A.J.B.), University of California, San Francisco; and ENCORE Expertise Center for Neurodevelopmental Disorders (M.C.Y.W., M.H.G.D., G.M.S.M.), ErasmusMC University Medical Center, Rotterdam, the Netherlands.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • For correspondence: r.schot@erasmusmc.nl
Martina Wilke
From the Department of Clinical Genetics (D.J.S., R.S., M.W., M.S., G.M.S.M.), ErasmusMC University Medical Center Rotterdam; Department of Child Neurology (M.C.Y.W.) and Department of Radiology (M.H.G.D.), Sophia Children's Hospital, ErasmusMC University Medical Center Rotterdam, the Netherlands; Department of Pediatrics (W.B.D.), University of Washington; Department of Neurology (W.B.D.), University of Washington, Seattle; Center for Integrative Brain Research (W.B.D.), Seattle Children's Research Institute, WA; Department of Human Genetics (W.B.D.), University of Minnesota, Minneapolis; Department of Radiology and Biomedical Imaging (A.J.B.), University of California, San Francisco; and ENCORE Expertise Center for Neurodevelopmental Disorders (M.C.Y.W., M.H.G.D., G.M.S.M.), ErasmusMC University Medical Center, Rotterdam, the Netherlands.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • For correspondence: m.wilke@erasmusmc.nl
Marjon van Slegtenhorst
From the Department of Clinical Genetics (D.J.S., R.S., M.W., M.S., G.M.S.M.), ErasmusMC University Medical Center Rotterdam; Department of Child Neurology (M.C.Y.W.) and Department of Radiology (M.H.G.D.), Sophia Children's Hospital, ErasmusMC University Medical Center Rotterdam, the Netherlands; Department of Pediatrics (W.B.D.), University of Washington; Department of Neurology (W.B.D.), University of Washington, Seattle; Center for Integrative Brain Research (W.B.D.), Seattle Children's Research Institute, WA; Department of Human Genetics (W.B.D.), University of Minnesota, Minneapolis; Department of Radiology and Biomedical Imaging (A.J.B.), University of California, San Francisco; and ENCORE Expertise Center for Neurodevelopmental Disorders (M.C.Y.W., M.H.G.D., G.M.S.M.), ErasmusMC University Medical Center, Rotterdam, the Netherlands.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • For correspondence: m.vanslegtenhorst@erasmusmc.nl
Marie Claire Y. de Wit
From the Department of Clinical Genetics (D.J.S., R.S., M.W., M.S., G.M.S.M.), ErasmusMC University Medical Center Rotterdam; Department of Child Neurology (M.C.Y.W.) and Department of Radiology (M.H.G.D.), Sophia Children's Hospital, ErasmusMC University Medical Center Rotterdam, the Netherlands; Department of Pediatrics (W.B.D.), University of Washington; Department of Neurology (W.B.D.), University of Washington, Seattle; Center for Integrative Brain Research (W.B.D.), Seattle Children's Research Institute, WA; Department of Human Genetics (W.B.D.), University of Minnesota, Minneapolis; Department of Radiology and Biomedical Imaging (A.J.B.), University of California, San Francisco; and ENCORE Expertise Center for Neurodevelopmental Disorders (M.C.Y.W., M.H.G.D., G.M.S.M.), ErasmusMC University Medical Center, Rotterdam, the Netherlands.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • For correspondence: m.c.y.dewit@erasmusmc.nl
Marjolein H.G. Dremmen
From the Department of Clinical Genetics (D.J.S., R.S., M.W., M.S., G.M.S.M.), ErasmusMC University Medical Center Rotterdam; Department of Child Neurology (M.C.Y.W.) and Department of Radiology (M.H.G.D.), Sophia Children's Hospital, ErasmusMC University Medical Center Rotterdam, the Netherlands; Department of Pediatrics (W.B.D.), University of Washington; Department of Neurology (W.B.D.), University of Washington, Seattle; Center for Integrative Brain Research (W.B.D.), Seattle Children's Research Institute, WA; Department of Human Genetics (W.B.D.), University of Minnesota, Minneapolis; Department of Radiology and Biomedical Imaging (A.J.B.), University of California, San Francisco; and ENCORE Expertise Center for Neurodevelopmental Disorders (M.C.Y.W., M.H.G.D., G.M.S.M.), ErasmusMC University Medical Center, Rotterdam, the Netherlands.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • For correspondence: m.dremmen@erasmusmc.nl
William B. Dobyns
From the Department of Clinical Genetics (D.J.S., R.S., M.W., M.S., G.M.S.M.), ErasmusMC University Medical Center Rotterdam; Department of Child Neurology (M.C.Y.W.) and Department of Radiology (M.H.G.D.), Sophia Children's Hospital, ErasmusMC University Medical Center Rotterdam, the Netherlands; Department of Pediatrics (W.B.D.), University of Washington; Department of Neurology (W.B.D.), University of Washington, Seattle; Center for Integrative Brain Research (W.B.D.), Seattle Children's Research Institute, WA; Department of Human Genetics (W.B.D.), University of Minnesota, Minneapolis; Department of Radiology and Biomedical Imaging (A.J.B.), University of California, San Francisco; and ENCORE Expertise Center for Neurodevelopmental Disorders (M.C.Y.W., M.H.G.D., G.M.S.M.), ErasmusMC University Medical Center, Rotterdam, the Netherlands.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • For correspondence: wbdobyns@umn.edu
A. James Barkovich
From the Department of Clinical Genetics (D.J.S., R.S., M.W., M.S., G.M.S.M.), ErasmusMC University Medical Center Rotterdam; Department of Child Neurology (M.C.Y.W.) and Department of Radiology (M.H.G.D.), Sophia Children's Hospital, ErasmusMC University Medical Center Rotterdam, the Netherlands; Department of Pediatrics (W.B.D.), University of Washington; Department of Neurology (W.B.D.), University of Washington, Seattle; Center for Integrative Brain Research (W.B.D.), Seattle Children's Research Institute, WA; Department of Human Genetics (W.B.D.), University of Minnesota, Minneapolis; Department of Radiology and Biomedical Imaging (A.J.B.), University of California, San Francisco; and ENCORE Expertise Center for Neurodevelopmental Disorders (M.C.Y.W., M.H.G.D., G.M.S.M.), ErasmusMC University Medical Center, Rotterdam, the Netherlands.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • For correspondence: james.barkovich@ucsf.edu
Grazia M.S. Mancini
From the Department of Clinical Genetics (D.J.S., R.S., M.W., M.S., G.M.S.M.), ErasmusMC University Medical Center Rotterdam; Department of Child Neurology (M.C.Y.W.) and Department of Radiology (M.H.G.D.), Sophia Children's Hospital, ErasmusMC University Medical Center Rotterdam, the Netherlands; Department of Pediatrics (W.B.D.), University of Washington; Department of Neurology (W.B.D.), University of Washington, Seattle; Center for Integrative Brain Research (W.B.D.), Seattle Children's Research Institute, WA; Department of Human Genetics (W.B.D.), University of Minnesota, Minneapolis; Department of Radiology and Biomedical Imaging (A.J.B.), University of California, San Francisco; and ENCORE Expertise Center for Neurodevelopmental Disorders (M.C.Y.W., M.H.G.D., G.M.S.M.), ErasmusMC University Medical Center, Rotterdam, the Netherlands.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Full PDF
Citation
Biallelic DAB1 Variants Are Associated With Mild Lissencephaly and Cerebellar Hypoplasia
Daphne J. Smits, Rachel Schot, Martina Wilke, Marjon van Slegtenhorst, Marie Claire Y. de Wit, Marjolein H.G. Dremmen, William B. Dobyns, A. James Barkovich, Grazia M.S. Mancini
Neurol Genet Apr 2021, 7 (2) e558; DOI: 10.1212/NXG.0000000000000558

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Permissions

Make Comment

See Comments

Downloads
306

Share

  • Article
  • Figures & Data
  • Info & Disclosures
Loading

Abstract

Objective We aimed to identify pathogenic variants in a girl with epilepsy, developmental delay, cerebellar ataxia, oral motor difficulty, and structural brain abnormalities with the use of whole-exome sequencing.

Methods Whole-exome trio analysis and molecular functional studies were performed in addition to the clinical findings and neuroimaging studies.

Results Brain MRI showed mild pachygyria, hypoplasia of the cerebellar vermis, and abnormal foliation of the cerebellar vermis, suspected for a variant in one of the genes of the Reelin pathway. Trio whole-exome sequencing and additional functional studies were performed to identify the pathogenic variants. Trio whole-exome sequencing revealed compound heterozygous splice variants in DAB1, both affecting the highly conserved functional phosphotyrosine-binding domain. Expression studies in patient-derived cells showed loss of normal transcripts, confirming pathogenicity.

Conclusions We conclude that these variants are very likely causally related to the cerebral phenotype and propose to consider loss-of-function DAB1 variants in patients with RELN-like cortical malformations.

Glossary

GoF=
gain of function;
LoF=
loss of function;
PTB=
phosphotyrosine binding;
WES=
whole-exome sequencing

The Disabled-1 (DAB1) gene encodes a key regulator in Reelin signaling, a critical pathway mediating correct positioning of neurons within the developing brain.1,2 In mice, both Dab1 and Reln are essential for proper cortical layering during embryonic development. Binding of Reelin to the lipoprotein receptors VLDLR and APOER2 on the neuronal surface leads to phosphorylation of DAB1 and activates downstream signaling cascades. Dab1-depleted mice present with a phenotype comparable to Reelin-deficient mice, including disruption of neuronal layering in the cerebral cortex, hippocampus, and cerebellum.3

Yet, human loss-of-function (LoF) mutations in DAB1 have not been described, whereas biallelic LoF mutations in RELN (OMIM #600514) are well known to cause a similar phenotype as seen in the murine counterpart. Recessive RELN variants cause a distinctive lissencephaly, associated with prominent hypoplasia of the pons, the cerebellar hemispheres, and the vermis.4 A similar but milder phenotype is described for VLDLR (OMIM #192977) variants.5 The only human disease related to DAB1 is spinocerebellar ataxia type-37 (SCA37, OMIM #615945), caused by (ATTTC)n insertions in the 5′UTR of DAB1.6 Several studies show that SCA37 occurs through gain-of-function (GoF) mechanisms, of which only 1 is directly related to DAB1 expression because the insertion results in overexpression of DAB1 protein and alternative DAB1 transcripts.7

Here, we report a patient with biallelic LoF variants in DAB1, presenting with RELN-like malformations including mild lissencephaly and cerebellar hypoplasia.

Methods

Consent

The study was approved by the local IRBs (Erasmus MC Rotterdam, protocol METC-2012387). Written informed consent to participate in this study was obtained from the parents of the participant.

Whole-Exome Sequencing

Whole-exome sequencing (WES) was performed on the Agilent Sure Select platform (Clinical research Exome Capture), run on HiSeq (101bp paired-end, Illumina), using the diagnostic certified pipeline of the department of Clinical Genetics, ErasmusMC, Rotterdam. The average coverage is ∼50×. Data are demultiplexed by the Illumina Software CASAVA. Reads are mapped with the program BWA (bio-bwa.sourceforge.net/). Variants are detected with the Genome Analysis Toolkit (broadinstitute.org/gatk/). The Variant Calling File is filtered in Alissa Interpret.

Sanger Sequencing

Amplification reactions were conducted according to standard methods and purified with ExoSAP-IT (USB). Direct sequencing was performed with Big Dye Terminator chemistry (Applied Biosystems). DNA fragment analysis was performed with capillary electrophoresis on an ABI3130 Genetic Analyzer (Applied Biosystems) with the software package Seqscape (Applied Biosystems).

Quantitative Reverse Transcription PCR

Fibroblasts from skin biopsies were grown in DMEM (10% fetal bovine serum, 1% l-glutamine, and 1% penicillin/streptomycin) at 37°C and 5% CO2, followed by RNA isolation using the RNeasy mini kit (QIAGEN). RNA was reverse transcribed with the iScript cDNA synthesis kit (Bio-Rad Laboratories). Quantitative reverse transcription PCR was performed using iTaq Universal SYBR Green Supermix (Bio-Rad) and the following primer sequences: DAB1_rt_c307_1F:TCGGGATTGATGAAGTTTCC;DAB1_rt_c307_1R:AGCCTCAAACACAATGTACTGG;DAB1_rt_c67_2F:GAGGATGCTCTGGGCTAGG;DAB1_rt_c67_2R:AAAGATTTTGATTCCTCCAAAGG.

Data Availability

WES data are deposited at the ISO certified diagnostic laboratory of the Department of Clinical Genetics, Erasmus MC, in respect to the family's privacy.

Results

Case Report

The affected individual was born at term after an uneventful delivery from unrelated healthy parents. In infancy, she had gastrointestinal reflux and excessive crying. She tolled over at 8 months, sat unsupported at 14 months, and walked at age 3 years. Cognitive development initially raised no concern, but during the first years, learning problems became apparent and she now attends special school (IQ: 50–60). The onset of focal epilepsy was at age 6 years; seizure semiology was loss of awareness, staring, without clear motor signs. Oxcarbazepine (8 mg/d) reduced seizure frequency, but absences persist once/twice a week without additional signs. Physical examination at age 11 years showed mild cerebellar ataxia, oculomotor apraxia, mild dysmetria of the upper extremities, impaired tandem gait, impaired facial muscle coordination, dysarthria, instability during Romberg test, dysdiadokokinesis, squint, mild pyramidal signs, joint hypermobility, normal muscular tone, and symmetrically low deep tendon reflexes. Head circumference was −1 SD; weight and height were within the normal range. Standard EEG at age 10 years showed no epileptic activity, normal posterior activity, excess of theta and delta waves in frontopolar, frontal, and temporal areas with occasional sharp waves in frontotemporal regions (left more than right), and normal photic stimulation response. Brain MRI at age 12 years showed cortical malformations reminiscent of RELN-related malformations, including mild pachygyria, i.e., decreased number of gyri with moderately thickened cortex (more prominent in the frontal lobes), mildly thin corpus callosum, enlarged perivascular spaces, and mildly enlarged lateral ventricles. The cerebellar vermis was hypoplastic and showed abnormal foliation. Abnormal foliation was observed to a lesser extent in the cerebellar hemispheres. The pons, the basal ganglia, and the hippocampal folding were normal (figure 1).

Figure 1
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 1 Brain MRI

Brain MRI of the affected individual with axial T2-weighted images (A–E), coronal T2-weighted images (F and G), and midsagittal T1-weighted image (H). Mild and diffuse cortical pachygyria more prominent in the frontal lobes (arrow in A and D), mildly thin corpus callosum (H, arrow), hypoplasia and abnormal foliation of cerebellar hemispheres (E and F, arrow head) and more pronounced vermis hypoplasia (H, arrow head), enlarged perivascular spaces (A–G), and lateral ventricles (B and G, arrow), all reminiscent of an RELN/VLDLR pattern.

Genomic Analysis and Expression Studies

High-resolution genomic microarrays showed normal female pattern. Sanger sequencing of RELN was normal. WES trio analysis identified compound heterozygosity for DAB1 splice site variants. The first variant (Chr1(GRCh37):g.57756635C>A NM_021080.3 c.67+1G>T, p.?) is located in the splice donor site of intron 4 and has never been reported in GnomAD. Splice prediction programs (MaxEntScan, NNSPLICE, GeneSplicer) predict an in-frame deletion of exon 4. Of interest, this deletion eliminates the ATG initiation site and the corresponding Kozak consensus sequence. Reverse transcription PCR on cDNA-derived from fibroblasts confirmed that the c.67+1G>T variant leads to a shorter, but stable, transcript (figure 2A). The second variant (Chr1(GRCh37):g.57538089T>A NM_021080.3 c.307-2A>T, r.307_315del9 p.Ala103_Gln105del) affects the splice acceptor site of intron 6, resulting in an in-frame deletion of 3 amino acids of exon 7, which are part of a β-sheet forming the highly conserved phosphotyrosine-binding (PTB) domain (figure 2B). Sanger sequencing confirmed this deletion (figure 2C). Heterozygosity was confirmed for both parents. Despite database searches (genematcher.org) and international contacts (Neuro-MIG), we did not identify another individual with a similar phenotype.

Figure 2
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 2 Functional Analysis of DAB1 Variants

(A) RT-PCR of DAB1 mRNA from the affected individual(p) and 5 age- and sex-matched control samples(c1-5). Primers were designed to amplify a product of 450 bp for the 67+1G>T variant and a product of 470 bp for the 307-2A>T variant. For the 67+1G>T variant, an alternative mRNA splice product is formed in the affected individual, which could be explained by the deletion of exon 4 (exon 4 contains 203 bp). (B) Structural model of the DAB1 PTB domain. The panel (B.a) shows the structure of the entire domain. Localization of the deleted amino acids is depicted in the other panels (B.b–B.d). (C) Sanger sequencing results of the c.307-2A>T transcript. PTB = phosphotyrosine binding; RT-PCR = reverse transcription PCR.

Discussion

Here, we report an individual with biallelic splice variants in DAB1. Given the RELN-like phenotype at MRI and the similarities of our patient with RELN/VLDRL-associated phenotypes, we conclude that the observed DAB1 variants are very likely related to the cerebral malformations in our patient.4,5 The DAB1 splice variants in our patient result in alternative transcripts affecting the highly conserved PTB domain. Translation of any DAB1 isoform containing this domain from the c.67+1G>T transcript is unlikely because it eliminates the methionine start codon. The c.307-2A>Tp.Ala103_Gln105del variant results in a protein containing this domain, but with a deletion of 3 amino acids, most likely altering protein folding. Although the precise effect of this deletion on protein structure and binding capacities remains unclear, the heterozygote parent carrying the c.67+1G>T p.? variant is healthy, supporting the additional pathogenic effect of the c.307-2A>Tp.Ala103_Gln105del variant.

In vitro, the PTB domain binds to cytoplasmic tails of the VLDLR and apoER2. This interaction is essential because binding of Reelin to these receptors induces DAB1 tyrosine phosphorylation and subsequent activation of downstream signaling pathways. Mice lacking the DAB1 PTB domain show almost complete absence of distinct cell layers in the cortex, a small and unfoliated cerebellum, and abnormal neuronal layering in the hippocampus.3

GoF mechanisms have been previously described in relation to DAB1 autosomal dominant mutations, causing SCA37.6 Although our patient presents with mild cerebellar ataxia, most of the phenotypic features are very distinguishable from SCA37.7,8 The proposed mechanisms causing SCA37 (e.g., DAB1 overexpression, RNA foci formation) are very distinct from the effect of the LoF variants described here, which explains the phenotypic differences and the early age at onset in our patient. Our results indicate that DAB1 LoF variants should be considered in patients with RELN-like cortical malformations at MRI. In addition, we propose inclusion of DAB1 in diagnostic exome panels devoted to brain malformations, intellectual disability, and epilepsy.

Study Funding

No targeted funding reported.

Disclosure

The authors report no disclosures. Go to Neurology.org/NG for full disclosures.

Acknowledgment

The authors thank the patient family for participation in the study. The Neuro-MIG network, (COST Action CA16118 neuro-MIG.org), fostered interaction among the authors D.J. Smits, M. Wilke, W.B. Dobyns, A.J. Barkovich, and G.M.S. Mancini.

Appendix Authors

Table

Footnotes

  • Go to Neurology.org/NG for full disclosures. Funding information is provided at the end of the article.

  • The Article Processing Charge was funded by the authors.

  • Received September 3, 2020.
  • Accepted in final form December 2, 2020.
  • Copyright © 2021 The Author(s). Published by Wolters Kluwer Health, Inc. on behalf of the American Academy of Neurology.

This is an open access article distributed under the terms of the Creative Commons Attribution-NonCommercial-NoDerivatives License 4.0 (CC BY-NC-ND), which permits downloading and sharing the work provided it is properly cited. The work cannot be changed in any way or used commercially without permission from the journal.

References

  1. 1.↵
    1. Howell BW,
    2. Lanier LM,
    3. Frank R,
    4. Gertler FB,
    5. Cooper JA
    . The disabled 1 phosphotyrosine-binding domain binds to the internalization signals of transmembrane glycoproteins and to phospholipids. Mol Cell Biol 1999;19:5179–5188.
    OpenUrlAbstract/FREE Full Text
  2. 2.↵
    1. Zhang JH,
    2. Zhao YF,
    3. He XX, et al
    . DCC-mediated Dab1 phosphorylation participates in the multipolar-to-bipolar transition of migrating neurons. Cell Rep 2018;22:3598–3611.
    OpenUrlCrossRefPubMed
  3. 3.↵
    1. Howell BW,
    2. Hawkes R,
    3. Soriano P,
    4. Cooper JA
    . Neuronal position in the developing brain is regulated by mouse disabled-1. Nature 1997;389:733–737.
    OpenUrlCrossRefPubMed
  4. 4.↵
    1. Hong SE,
    2. Shugart YY,
    3. Huang DT, et al
    . Autosomal recessive lissencephaly with cerebellar hypoplasia is associated with human RELN mutations. Nat Genet 2000;26:93–96.
    OpenUrlCrossRefPubMed
  5. 5.↵
    1. Valence S,
    2. Garel C,
    3. Barth M, et al
    . RELN and VLDLR mutations underlie two distinguishable clinico-radiological phenotypes. Clin Genet 2016;90:545–549.
    OpenUrl
  6. 6.↵
    1. Loureiro JR,
    2. Oliveira CL,
    3. Mota C, et al
    . Mutational mechanism for DAB1 (ATTTC)n insertion in SCA37: ATTTT repeat lengthening and nucleotide substitution. Hum Mutat 2019;40:404–412.
    OpenUrl
  7. 7.↵
    1. Corral-Juan M,
    2. Serrano-Munuera C,
    3. Rabano A, et al
    . Clinical, genetic and neuropathological characterization of spinocerebellar ataxia type 37. Brain 2018;141:1981–1997.
    OpenUrl
  8. 8.↵
    1. Seixas AI,
    2. Loureiro JR,
    3. Costa C, et al
    . A pentanucleotide ATTTC repeat insertion in the non-coding region of DAB1, mapping to SCA37, causes spinocerebellar ataxia. Am J Hum Genet 2017;101:87–103.
    OpenUrlCrossRefPubMed

Letters: Rapid online correspondence

No comments have been published for this article.
Comment

REQUIREMENTS

If you are uploading a letter concerning an article:
You must have updated your disclosures within six months: http://submit.neurology.org

Your co-authors must send a completed Publishing Agreement Form to Neurology Staff (not necessary for the lead/corresponding author as the form below will suffice) before you upload your comment.

If you are responding to a comment that was written about an article you originally authored:
You (and co-authors) do not need to fill out forms or check disclosures as author forms are still valid
and apply to letter.

Submission specifications:

  • Submissions must be < 200 words with < 5 references. Reference 1 must be the article on which you are commenting.
  • Submissions should not have more than 5 authors. (Exception: original author replies can include all original authors of the article)
  • Submit only on articles published within 6 months of issue date.
  • Do not be redundant. Read any comments already posted on the article prior to submission.
  • Submitted comments are subject to editing and editor review prior to posting.

More guidelines and information on Disputes & Debates

Compose Comment

More information about text formats

Plain text

  • No HTML tags allowed.
  • Web page addresses and e-mail addresses turn into links automatically.
  • Lines and paragraphs break automatically.
Author Information
NOTE: The first author must also be the corresponding author of the comment.
First or given name, e.g. 'Peter'.
Your last, or family, name, e.g. 'MacMoody'.
Your email address, e.g. higgs-boson@gmail.com
Your role and/or occupation, e.g. 'Orthopedic Surgeon'.
Your organization or institution (if applicable), e.g. 'Royal Free Hospital'.
Publishing Agreement
NOTE: All authors, besides the first/corresponding author, must complete a separate Publishing Agreement Form and provide via email to the editorial office before comments can be posted.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.

Vertical Tabs

You May Also be Interested in

Back to top
  • Article
    • Abstract
    • Glossary
    • Methods
    • Results
    • Discussion
    • Study Funding
    • Disclosure
    • Acknowledgment
    • Appendix Authors
    • Footnotes
    • References
  • Figures & Data
  • Info & Disclosures

Related Articles

  • No related articles found.

Topics Discussed

  • All Epilepsy/Seizures
  • All Genetics
  • Developmental disorders
  • MRI
  • Cerebellum

Alert Me

  • Alert me when eletters are published
Advertisement
Neurology Genetics: 8 (4)

Articles

  • Articles
  • Issues
  • Popular Articles

About

  • About the Journals
  • Ethics Policies
  • Editors & Editorial Board
  • Contact Us
  • Advertise

Submit

  • Author Center
  • Submit a Manuscript
  • Information for Reviewers
  • AAN Guidelines
  • Permissions

Subscribers

  • Subscribe
  • Sign up for eAlerts
  • RSS Feed
Site Logo
  • Visit neurology Template on Facebook
  • Follow neurology Template on Twitter
  • Visit Neurology on YouTube
  • Neurology
  • Neurology: Clinical Practice
  • Neurology: Genetics
  • Neurology: Neuroimmunology & Neuroinflammation
  • Neurology: Education
  • AAN.com
  • AANnews
  • Continuum
  • Brain & Life
  • Neurology Today

Wolters Kluwer Logo

Neurology: Genetics | Online ISSN: 2376-7839

© 2022 American Academy of Neurology

  • Privacy Policy
  • Feedback
  • Advertise