Skip to main content
Advertisement
  • Neurology.org
  • Journals
    • Neurology
    • Clinical Practice
    • Education
    • Genetics
    • Neuroimmunology & Neuroinflammation
  • Online Sections
    • Neurology Video Journal Club
    • Inclusion, Diversity, Equity, Anti-racism, & Social Justice (IDEAS)
    • Innovations in Care Delivery
    • Practice Buzz
    • Practice Current
    • Residents & Fellows
    • Without Borders
  • Collections
    • COVID-19
    • Disputes & Debates
    • Health Disparities
    • Infographics
    • Null Hypothesis
    • Patient Pages
    • Translations
    • Topics A-Z
  • Podcast
  • CME
  • About
    • About the Journals
    • Contact Us
    • Editorial Board
  • Authors
    • Submit a Manuscript
    • Author Center

Advanced Search

Main menu

  • Neurology.org
  • Journals
    • Neurology
    • Clinical Practice
    • Education
    • Genetics
    • Neuroimmunology & Neuroinflammation
  • Online Sections
    • Neurology Video Journal Club
    • Inclusion, Diversity, Equity, Anti-racism, & Social Justice (IDEAS)
    • Innovations in Care Delivery
    • Practice Buzz
    • Practice Current
    • Residents & Fellows
    • Without Borders
  • Collections
    • COVID-19
    • Disputes & Debates
    • Health Disparities
    • Infographics
    • Null Hypothesis
    • Patient Pages
    • Translations
    • Topics A-Z
  • Podcast
  • CME
  • About
    • About the Journals
    • Contact Us
    • Editorial Board
  • Authors
    • Submit a Manuscript
    • Author Center
  • Home
  • Articles
  • Issues

User menu

  • My Alerts
  • Log in

Search

  • Advanced search
Neurology Genetics
Home
A peer-reviewed clinical and translational neurology open access journal
  • My Alerts
  • Log in
Site Logo
  • Home
  • Articles
  • Issues

Share

April 2016; 2 (2) ArticleOpen Access

Homozygous deletion in MICU1 presenting with fatigue and lethargy in childhood

David Lewis-Smith, Kimberli J. Kamer, Helen Griffin, Anne-Marie Childs, Karen Pysden, Denis Titov, Jennifer Duff, Angela Pyle, Robert W. Taylor, Patrick Yu-Wai-Man, Venkateswaran Ramesh, Rita Horvath, Vamsi K. Mootha, Patrick F. Chinnery
First published March 3, 2016, DOI: https://doi.org/10.1212/NXG.0000000000000059
David Lewis-Smith
From the Wellcome Trust Centre for Mitochondrial Research (D.L.-S., H.G., J.D., A.P., R.W.T., P.Y.-W.-M., R.H., P.F.C.), Institute of Genetic Medicine (D.L.-S., H.G., J.D., A.P., P.Y.-W.-M., R.H.), and Institute of Neuroscience (R.W.T.), Newcastle University, Newcastle upon Tyne, United Kingdom; Howard Hughes Medical Institute (K.J.K., D.T., V.K.M.), Department of Molecular Biology, Massachusetts General Hospital, Boston, MA; Department of Paediatric Neurology (A.-M.C., K.P.), The General Infirmary, Leeds, United Kingdom; Department of Child Neurology (V.R.), The Royal Victoria Infirmary, Newcastle upon Tyne Hospitals NHS Trust, Newcastle upon Tyne, United Kingdom; Department of Systems Biology (V.K.M.), Harvard Medical School, Boston, MA; Broad Institute (V.K.M.), Cambridge, MA; Department of Clinical Neurosciences (P.F.C.), University of Cambridge; and MRC Mitochondrial Biology Unit (P.F.C.), Cambridge Biomedical Campus, United Kingdom.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Kimberli J. Kamer
From the Wellcome Trust Centre for Mitochondrial Research (D.L.-S., H.G., J.D., A.P., R.W.T., P.Y.-W.-M., R.H., P.F.C.), Institute of Genetic Medicine (D.L.-S., H.G., J.D., A.P., P.Y.-W.-M., R.H.), and Institute of Neuroscience (R.W.T.), Newcastle University, Newcastle upon Tyne, United Kingdom; Howard Hughes Medical Institute (K.J.K., D.T., V.K.M.), Department of Molecular Biology, Massachusetts General Hospital, Boston, MA; Department of Paediatric Neurology (A.-M.C., K.P.), The General Infirmary, Leeds, United Kingdom; Department of Child Neurology (V.R.), The Royal Victoria Infirmary, Newcastle upon Tyne Hospitals NHS Trust, Newcastle upon Tyne, United Kingdom; Department of Systems Biology (V.K.M.), Harvard Medical School, Boston, MA; Broad Institute (V.K.M.), Cambridge, MA; Department of Clinical Neurosciences (P.F.C.), University of Cambridge; and MRC Mitochondrial Biology Unit (P.F.C.), Cambridge Biomedical Campus, United Kingdom.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Helen Griffin
From the Wellcome Trust Centre for Mitochondrial Research (D.L.-S., H.G., J.D., A.P., R.W.T., P.Y.-W.-M., R.H., P.F.C.), Institute of Genetic Medicine (D.L.-S., H.G., J.D., A.P., P.Y.-W.-M., R.H.), and Institute of Neuroscience (R.W.T.), Newcastle University, Newcastle upon Tyne, United Kingdom; Howard Hughes Medical Institute (K.J.K., D.T., V.K.M.), Department of Molecular Biology, Massachusetts General Hospital, Boston, MA; Department of Paediatric Neurology (A.-M.C., K.P.), The General Infirmary, Leeds, United Kingdom; Department of Child Neurology (V.R.), The Royal Victoria Infirmary, Newcastle upon Tyne Hospitals NHS Trust, Newcastle upon Tyne, United Kingdom; Department of Systems Biology (V.K.M.), Harvard Medical School, Boston, MA; Broad Institute (V.K.M.), Cambridge, MA; Department of Clinical Neurosciences (P.F.C.), University of Cambridge; and MRC Mitochondrial Biology Unit (P.F.C.), Cambridge Biomedical Campus, United Kingdom.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Anne-Marie Childs
From the Wellcome Trust Centre for Mitochondrial Research (D.L.-S., H.G., J.D., A.P., R.W.T., P.Y.-W.-M., R.H., P.F.C.), Institute of Genetic Medicine (D.L.-S., H.G., J.D., A.P., P.Y.-W.-M., R.H.), and Institute of Neuroscience (R.W.T.), Newcastle University, Newcastle upon Tyne, United Kingdom; Howard Hughes Medical Institute (K.J.K., D.T., V.K.M.), Department of Molecular Biology, Massachusetts General Hospital, Boston, MA; Department of Paediatric Neurology (A.-M.C., K.P.), The General Infirmary, Leeds, United Kingdom; Department of Child Neurology (V.R.), The Royal Victoria Infirmary, Newcastle upon Tyne Hospitals NHS Trust, Newcastle upon Tyne, United Kingdom; Department of Systems Biology (V.K.M.), Harvard Medical School, Boston, MA; Broad Institute (V.K.M.), Cambridge, MA; Department of Clinical Neurosciences (P.F.C.), University of Cambridge; and MRC Mitochondrial Biology Unit (P.F.C.), Cambridge Biomedical Campus, United Kingdom.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Karen Pysden
From the Wellcome Trust Centre for Mitochondrial Research (D.L.-S., H.G., J.D., A.P., R.W.T., P.Y.-W.-M., R.H., P.F.C.), Institute of Genetic Medicine (D.L.-S., H.G., J.D., A.P., P.Y.-W.-M., R.H.), and Institute of Neuroscience (R.W.T.), Newcastle University, Newcastle upon Tyne, United Kingdom; Howard Hughes Medical Institute (K.J.K., D.T., V.K.M.), Department of Molecular Biology, Massachusetts General Hospital, Boston, MA; Department of Paediatric Neurology (A.-M.C., K.P.), The General Infirmary, Leeds, United Kingdom; Department of Child Neurology (V.R.), The Royal Victoria Infirmary, Newcastle upon Tyne Hospitals NHS Trust, Newcastle upon Tyne, United Kingdom; Department of Systems Biology (V.K.M.), Harvard Medical School, Boston, MA; Broad Institute (V.K.M.), Cambridge, MA; Department of Clinical Neurosciences (P.F.C.), University of Cambridge; and MRC Mitochondrial Biology Unit (P.F.C.), Cambridge Biomedical Campus, United Kingdom.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Denis Titov
From the Wellcome Trust Centre for Mitochondrial Research (D.L.-S., H.G., J.D., A.P., R.W.T., P.Y.-W.-M., R.H., P.F.C.), Institute of Genetic Medicine (D.L.-S., H.G., J.D., A.P., P.Y.-W.-M., R.H.), and Institute of Neuroscience (R.W.T.), Newcastle University, Newcastle upon Tyne, United Kingdom; Howard Hughes Medical Institute (K.J.K., D.T., V.K.M.), Department of Molecular Biology, Massachusetts General Hospital, Boston, MA; Department of Paediatric Neurology (A.-M.C., K.P.), The General Infirmary, Leeds, United Kingdom; Department of Child Neurology (V.R.), The Royal Victoria Infirmary, Newcastle upon Tyne Hospitals NHS Trust, Newcastle upon Tyne, United Kingdom; Department of Systems Biology (V.K.M.), Harvard Medical School, Boston, MA; Broad Institute (V.K.M.), Cambridge, MA; Department of Clinical Neurosciences (P.F.C.), University of Cambridge; and MRC Mitochondrial Biology Unit (P.F.C.), Cambridge Biomedical Campus, United Kingdom.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Jennifer Duff
From the Wellcome Trust Centre for Mitochondrial Research (D.L.-S., H.G., J.D., A.P., R.W.T., P.Y.-W.-M., R.H., P.F.C.), Institute of Genetic Medicine (D.L.-S., H.G., J.D., A.P., P.Y.-W.-M., R.H.), and Institute of Neuroscience (R.W.T.), Newcastle University, Newcastle upon Tyne, United Kingdom; Howard Hughes Medical Institute (K.J.K., D.T., V.K.M.), Department of Molecular Biology, Massachusetts General Hospital, Boston, MA; Department of Paediatric Neurology (A.-M.C., K.P.), The General Infirmary, Leeds, United Kingdom; Department of Child Neurology (V.R.), The Royal Victoria Infirmary, Newcastle upon Tyne Hospitals NHS Trust, Newcastle upon Tyne, United Kingdom; Department of Systems Biology (V.K.M.), Harvard Medical School, Boston, MA; Broad Institute (V.K.M.), Cambridge, MA; Department of Clinical Neurosciences (P.F.C.), University of Cambridge; and MRC Mitochondrial Biology Unit (P.F.C.), Cambridge Biomedical Campus, United Kingdom.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Angela Pyle
From the Wellcome Trust Centre for Mitochondrial Research (D.L.-S., H.G., J.D., A.P., R.W.T., P.Y.-W.-M., R.H., P.F.C.), Institute of Genetic Medicine (D.L.-S., H.G., J.D., A.P., P.Y.-W.-M., R.H.), and Institute of Neuroscience (R.W.T.), Newcastle University, Newcastle upon Tyne, United Kingdom; Howard Hughes Medical Institute (K.J.K., D.T., V.K.M.), Department of Molecular Biology, Massachusetts General Hospital, Boston, MA; Department of Paediatric Neurology (A.-M.C., K.P.), The General Infirmary, Leeds, United Kingdom; Department of Child Neurology (V.R.), The Royal Victoria Infirmary, Newcastle upon Tyne Hospitals NHS Trust, Newcastle upon Tyne, United Kingdom; Department of Systems Biology (V.K.M.), Harvard Medical School, Boston, MA; Broad Institute (V.K.M.), Cambridge, MA; Department of Clinical Neurosciences (P.F.C.), University of Cambridge; and MRC Mitochondrial Biology Unit (P.F.C.), Cambridge Biomedical Campus, United Kingdom.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Robert W. Taylor
From the Wellcome Trust Centre for Mitochondrial Research (D.L.-S., H.G., J.D., A.P., R.W.T., P.Y.-W.-M., R.H., P.F.C.), Institute of Genetic Medicine (D.L.-S., H.G., J.D., A.P., P.Y.-W.-M., R.H.), and Institute of Neuroscience (R.W.T.), Newcastle University, Newcastle upon Tyne, United Kingdom; Howard Hughes Medical Institute (K.J.K., D.T., V.K.M.), Department of Molecular Biology, Massachusetts General Hospital, Boston, MA; Department of Paediatric Neurology (A.-M.C., K.P.), The General Infirmary, Leeds, United Kingdom; Department of Child Neurology (V.R.), The Royal Victoria Infirmary, Newcastle upon Tyne Hospitals NHS Trust, Newcastle upon Tyne, United Kingdom; Department of Systems Biology (V.K.M.), Harvard Medical School, Boston, MA; Broad Institute (V.K.M.), Cambridge, MA; Department of Clinical Neurosciences (P.F.C.), University of Cambridge; and MRC Mitochondrial Biology Unit (P.F.C.), Cambridge Biomedical Campus, United Kingdom.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Patrick Yu-Wai-Man
From the Wellcome Trust Centre for Mitochondrial Research (D.L.-S., H.G., J.D., A.P., R.W.T., P.Y.-W.-M., R.H., P.F.C.), Institute of Genetic Medicine (D.L.-S., H.G., J.D., A.P., P.Y.-W.-M., R.H.), and Institute of Neuroscience (R.W.T.), Newcastle University, Newcastle upon Tyne, United Kingdom; Howard Hughes Medical Institute (K.J.K., D.T., V.K.M.), Department of Molecular Biology, Massachusetts General Hospital, Boston, MA; Department of Paediatric Neurology (A.-M.C., K.P.), The General Infirmary, Leeds, United Kingdom; Department of Child Neurology (V.R.), The Royal Victoria Infirmary, Newcastle upon Tyne Hospitals NHS Trust, Newcastle upon Tyne, United Kingdom; Department of Systems Biology (V.K.M.), Harvard Medical School, Boston, MA; Broad Institute (V.K.M.), Cambridge, MA; Department of Clinical Neurosciences (P.F.C.), University of Cambridge; and MRC Mitochondrial Biology Unit (P.F.C.), Cambridge Biomedical Campus, United Kingdom.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Venkateswaran Ramesh
From the Wellcome Trust Centre for Mitochondrial Research (D.L.-S., H.G., J.D., A.P., R.W.T., P.Y.-W.-M., R.H., P.F.C.), Institute of Genetic Medicine (D.L.-S., H.G., J.D., A.P., P.Y.-W.-M., R.H.), and Institute of Neuroscience (R.W.T.), Newcastle University, Newcastle upon Tyne, United Kingdom; Howard Hughes Medical Institute (K.J.K., D.T., V.K.M.), Department of Molecular Biology, Massachusetts General Hospital, Boston, MA; Department of Paediatric Neurology (A.-M.C., K.P.), The General Infirmary, Leeds, United Kingdom; Department of Child Neurology (V.R.), The Royal Victoria Infirmary, Newcastle upon Tyne Hospitals NHS Trust, Newcastle upon Tyne, United Kingdom; Department of Systems Biology (V.K.M.), Harvard Medical School, Boston, MA; Broad Institute (V.K.M.), Cambridge, MA; Department of Clinical Neurosciences (P.F.C.), University of Cambridge; and MRC Mitochondrial Biology Unit (P.F.C.), Cambridge Biomedical Campus, United Kingdom.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Rita Horvath
From the Wellcome Trust Centre for Mitochondrial Research (D.L.-S., H.G., J.D., A.P., R.W.T., P.Y.-W.-M., R.H., P.F.C.), Institute of Genetic Medicine (D.L.-S., H.G., J.D., A.P., P.Y.-W.-M., R.H.), and Institute of Neuroscience (R.W.T.), Newcastle University, Newcastle upon Tyne, United Kingdom; Howard Hughes Medical Institute (K.J.K., D.T., V.K.M.), Department of Molecular Biology, Massachusetts General Hospital, Boston, MA; Department of Paediatric Neurology (A.-M.C., K.P.), The General Infirmary, Leeds, United Kingdom; Department of Child Neurology (V.R.), The Royal Victoria Infirmary, Newcastle upon Tyne Hospitals NHS Trust, Newcastle upon Tyne, United Kingdom; Department of Systems Biology (V.K.M.), Harvard Medical School, Boston, MA; Broad Institute (V.K.M.), Cambridge, MA; Department of Clinical Neurosciences (P.F.C.), University of Cambridge; and MRC Mitochondrial Biology Unit (P.F.C.), Cambridge Biomedical Campus, United Kingdom.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Vamsi K. Mootha
From the Wellcome Trust Centre for Mitochondrial Research (D.L.-S., H.G., J.D., A.P., R.W.T., P.Y.-W.-M., R.H., P.F.C.), Institute of Genetic Medicine (D.L.-S., H.G., J.D., A.P., P.Y.-W.-M., R.H.), and Institute of Neuroscience (R.W.T.), Newcastle University, Newcastle upon Tyne, United Kingdom; Howard Hughes Medical Institute (K.J.K., D.T., V.K.M.), Department of Molecular Biology, Massachusetts General Hospital, Boston, MA; Department of Paediatric Neurology (A.-M.C., K.P.), The General Infirmary, Leeds, United Kingdom; Department of Child Neurology (V.R.), The Royal Victoria Infirmary, Newcastle upon Tyne Hospitals NHS Trust, Newcastle upon Tyne, United Kingdom; Department of Systems Biology (V.K.M.), Harvard Medical School, Boston, MA; Broad Institute (V.K.M.), Cambridge, MA; Department of Clinical Neurosciences (P.F.C.), University of Cambridge; and MRC Mitochondrial Biology Unit (P.F.C.), Cambridge Biomedical Campus, United Kingdom.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Patrick F. Chinnery
From the Wellcome Trust Centre for Mitochondrial Research (D.L.-S., H.G., J.D., A.P., R.W.T., P.Y.-W.-M., R.H., P.F.C.), Institute of Genetic Medicine (D.L.-S., H.G., J.D., A.P., P.Y.-W.-M., R.H.), and Institute of Neuroscience (R.W.T.), Newcastle University, Newcastle upon Tyne, United Kingdom; Howard Hughes Medical Institute (K.J.K., D.T., V.K.M.), Department of Molecular Biology, Massachusetts General Hospital, Boston, MA; Department of Paediatric Neurology (A.-M.C., K.P.), The General Infirmary, Leeds, United Kingdom; Department of Child Neurology (V.R.), The Royal Victoria Infirmary, Newcastle upon Tyne Hospitals NHS Trust, Newcastle upon Tyne, United Kingdom; Department of Systems Biology (V.K.M.), Harvard Medical School, Boston, MA; Broad Institute (V.K.M.), Cambridge, MA; Department of Clinical Neurosciences (P.F.C.), University of Cambridge; and MRC Mitochondrial Biology Unit (P.F.C.), Cambridge Biomedical Campus, United Kingdom.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Full PDF
Citation
Homozygous deletion in MICU1 presenting with fatigue and lethargy in childhood
David Lewis-Smith, Kimberli J. Kamer, Helen Griffin, Anne-Marie Childs, Karen Pysden, Denis Titov, Jennifer Duff, Angela Pyle, Robert W. Taylor, Patrick Yu-Wai-Man, Venkateswaran Ramesh, Rita Horvath, Vamsi K. Mootha, Patrick F. Chinnery
Neurol Genet Apr 2016, 2 (2) e59; DOI: 10.1212/NXG.0000000000000059

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Permissions

Make Comment

See Comments

Downloads
910

Share

  • Article
  • Figures & Data
  • Info & Disclosures
Loading

Article Figures & Data

Figures

  • Additional Files
  • Figure 1
    • Download figure
    • Open in new tab
    • Download powerpoint
    Figure 1 Pedigree of the family described in the case report

    IV:3 is the index case and IV:6 is her cousin. DNA was available for family members indicated with an asterisk, allowing the segregation analysis shown in figure 2. The 2 gray-shaded individuals have not been assessed in the United Kingdom: 1 failed to walk and died in infancy and the other is reported to have muscle problems.

  • Figure 2
    • Download figure
    • Open in new tab
    • Download powerpoint
    Figure 2 Identification of the deletion

    (A) Exome read depth across MICU1 for the 2 patients (IV:3 = patient 1, red; IV:6 = patient 2, yellow) and a representative control (blue) showing a likely homozygous deletion involving exon 1 in IV:3 and IV:6. (B) Long-range PCR primer walking demonstrated the limits of the deletion within the region identified through analysis of exome sequencing coverage (oligonucleotide primers shown as red and green bars). PCR amplification using the named primer pairs shows absence of a product with combination 74,387,000. − = no DNA control, + = healthy control. (C) Long-range PCR using the forward primer from pair 74,384,500 and the reverse primer from pair 74,388,250 amplified a ∼1-kb fragment from the 2 affected cousins, which was small enough for Sanger sequencing. Primers: Fwd TTCCCTTTCTCCTCAGGCAC, Rev GTCTACCGGATTCAGGCGAT. When compared with control DNA, this equated to a ∼2.7-kb homozygous deletion in the patients. (D) Sanger sequence from the 2 affected cousins (IV:3 and IV:6) showing the homozygous deletion breakpoint. Primers: Fwd TTCCCTTTCTCCTCAGGCAC, Rev GTCTACCGGATTCAGGCGAT. (E) Segregation analysis of the MICU1 deletion. PCR spanning the breakpoint showing the homozygous deletion in the 2 affected cousins (IV:3 and IV:6) and a heterozygous deletion in other family members (III:2, III:3, III:4, III:5, and IV:2). Primers: Fwd CCTGGGCGACAAGTGTAAAA Position Chr 10:74,381,222; Rev CCCAGGCATTTGATCACCAG Position Chr 10:74,390,095. Amplification of the mutant allele in heterozygous carriers of the MICU1 deletion produced an additional intermediate band of ∼8 kb that is unexplained but did not affect the segregation analysis. Other symbols refer to the pedigree shown in figure 1. WT = wild type.

  • Figure 3
    • Download figure
    • Open in new tab
    • Download powerpoint
    Figure 3 Loss of MICU1 leads to a deficit in mitochondrial calcium handling without impairing respiration

    (A) Oxygen consumption rates (OCR) and (B) extracellular acidification rates (ECAR) of MICU1+/− and MICU1−/− fibroblasts were measured by Seahorse XF analysis. Mean values ± SE (error bars) from 3 independent experiments are shown (differences are not statistically significant). (C) Immunoblot of whole cell lysates from MICU1+/− and MICU1−/− fibroblasts. (D) Digitonin-permeabilized fibroblasts were given a pulse of 35 μM CaCl2 while monitoring extramitochondrial Ca2+ with calcium green-5N.8 (E) Quantification of the rate of calcium uptake from calcium uptake traces including those in D (using linear fit from 30 to 40 seconds). Mean values ± SD (error bars) from 3 independent experiments are shown. (F) MICU1+/− (+) and MICU1−/− (−) fibroblasts were exposed to different conditions (untreated, 500 nM CCCP, 1 μM oligomycin, or serum starvation) and pyruvate dehydrogenase (PDH) and phosphorylated PDH (at S293) were measured by immunoblot after lysing the cells in 1% Triton-X-100, 150 mM NaCl, 25 mM Hepes pH 7.4, and protease and phosphatase inhibitors. (G) Quantification of 3 independent experiments including the representative experiment in F are shown. Mean values ± SE (error bars). MCU = mitochondrial Ca2+ uniporter; SDHB = succinate dehydrogenase subunit B.

Additional Files

  • Figures
  • Data Supplement

    Files in this Data Supplement:

    • Table e-1 - Microsoft Word file
  1. David Lewis-Smith, MRCP, MA, MBBChir,
  2. Kimberli J. Kamer,
  3. Helen Griffin, PhD,
  4. Anne-Marie Childs, FRCPCH,
  5. Karen Pysden, FRCPCH,
  6. Denis Titov, PhD,
  7. Jennifer Duff, PhD,
  8. Angela Pyle, PhD,
  9. Robert W. Taylor, PhD,
  10. Patrick Yu-Wai-Man, FRCOPth,
  11. Venkateswaran Ramesh, FRCPCH,
  12. Rita Horvath, MD, PhD*,
  13. Vamsi K. Mootha, MD* and
  14. Patrick F. Chinnery, FRCP, FMedSci*
  1. From the Wellcome Trust Centre for Mitochondrial Research (D.L.-S., H.G., J.D., A.P., R.W.T., P.Y.-W.-M., R.H., P.F.C.), Institute of Genetic Medicine (D.L.-S., H.G., J.D., A.P., P.Y.-W.-M., R.H.), and Institute of Neuroscience (R.W.T.), Newcastle University, Newcastle upon Tyne, United Kingdom; Howard Hughes Medical Institute (K.J.K., D.T., V.K.M.), Department of Molecular Biology, Massachusetts General Hospital, Boston, MA; Department of Paediatric Neurology (A.-M.C., K.P.), The General Infirmary, Leeds, United Kingdom; Department of Child Neurology (V.R.), The Royal Victoria Infirmary, Newcastle upon Tyne Hospitals NHS Trust, Newcastle upon Tyne, United Kingdom; Department of Systems Biology (V.K.M.), Harvard Medical School, Boston, MA; Broad Institute (V.K.M.), Cambridge, MA; Department of Clinical Neurosciences (P.F.C.), University of Cambridge; and MRC Mitochondrial Biology Unit (P.F.C.), Cambridge Biomedical Campus, United Kingdom.
  1. Correspondence to Dr. Chinnery: pfc25{at}medschl.cam.ac.uk
Scientific Advisory Boards:
  1. NONE

Gifts:
  1. NONE

Funding for Travel or Speaker Honoraria:
  1. NONE

Editorial Boards:
  1. NONE

Patents:
  1. NONE

Publishing Royalties:
  1. NONE

Employment, Commercial Entity:
  1. NONE

Consultancies:
  1. NONE

Speakers' Bureaus:
  1. NONE

Other Activities:
  1. NONE

Clinical Procedures or Imaging Studies:
  1. NONE

Research Support, Commercial Entities:
  1. NONE

Research Support, Government Entities:
  1. NONE

Research Support, Academic Entities:
  1. NONE

Research Support, Foundations and Societies:
  1. NONE

Stock/Stock Options/Board of Directors Compensation:
  1. NONE

License Fee Payments, Technology or Inventions:
  1. NONE

Royalty Payments, Technology or Inventions:
  1. NONE

Stock/Stock Options, Research Sponsor:
  1. NONE

Stock/Stock Options, Medical Equipment & Materials:
  1. NONE

Legal Proceedings:
  1. NONE

Scientific Advisory Boards:
  1. NONE

Gifts:
  1. NONE

Funding for Travel or Speaker Honoraria:
  1. NONE

Editorial Boards:
  1. NONE

Patents:
  1. NONE

Publishing Royalties:
  1. NONE

Employment, Commercial Entity:
  1. NONE

Consultancies:
  1. NONE

Speakers' Bureaus:
  1. NONE

Other Activities:
  1. NONE

Clinical Procedures or Imaging Studies:
  1. NONE

Research Support, Commercial Entities:
  1. NONE

Research Support, Government Entities:
  1. National Science Foundation Graduate Research Fellowship, 2011-2015

Research Support, Academic Entities:
  1. NONE

Research Support, Foundations and Societies:
  1. NONE

Stock/Stock Options/Board of Directors Compensation:
  1. NONE

License Fee Payments, Technology or Inventions:
  1. NONE

Royalty Payments, Technology or Inventions:
  1. NONE

Stock/Stock Options, Research Sponsor:
  1. NONE

Stock/Stock Options, Medical Equipment & Materials:
  1. NONE

Legal Proceedings:
  1. NONE

Scientific Advisory Boards:
  1. NONE

Gifts:
  1. NONE

Funding for Travel or Speaker Honoraria:
  1. NONE

Editorial Boards:
  1. NONE

Patents:
  1. NONE

Publishing Royalties:
  1. NONE

Employment, Commercial Entity:
  1. NONE

Consultancies:
  1. NONE

Speakers' Bureaus:
  1. NONE

Other Activities:
  1. NONE

Clinical Procedures or Imaging Studies:
  1. NONE

Research Support, Commercial Entities:
  1. NONE

Research Support, Government Entities:
  1. NONE

Research Support, Academic Entities:
  1. NONE

Research Support, Foundations and Societies:
  1. NONE

Stock/Stock Options/Board of Directors Compensation:
  1. NONE

License Fee Payments, Technology or Inventions:
  1. NONE

Royalty Payments, Technology or Inventions:
  1. NONE

Stock/Stock Options, Research Sponsor:
  1. NONE

Stock/Stock Options, Medical Equipment & Materials:
  1. NONE

Legal Proceedings:
  1. NONE

Scientific Advisory Boards:
  1. NONE

Gifts:
  1. NONE

Funding for Travel or Speaker Honoraria:
  1. NONE

Editorial Boards:
  1. NONE

Patents:
  1. NONE

Publishing Royalties:
  1. NONE

Employment, Commercial Entity:
  1. NONE

Consultancies:
  1. NONE

Speakers' Bureaus:
  1. NONE

Other Activities:
  1. NONE

Clinical Procedures or Imaging Studies:
  1. NONE

Research Support, Commercial Entities:
  1. NONE

Research Support, Government Entities:
  1. NONE

Research Support, Academic Entities:
  1. NONE

Research Support, Foundations and Societies:
  1. NONE

Stock/Stock Options/Board of Directors Compensation:
  1. NONE

License Fee Payments, Technology or Inventions:
  1. NONE

Royalty Payments, Technology or Inventions:
  1. NONE

Stock/Stock Options, Research Sponsor:
  1. NONE

Stock/Stock Options, Medical Equipment & Materials:
  1. NONE

Legal Proceedings:
  1. NONE

Scientific Advisory Boards:
  1. NONE

Gifts:
  1. NONE

Funding for Travel or Speaker Honoraria:
  1. NONE

Editorial Boards:
  1. NONE

Patents:
  1. NONE

Publishing Royalties:
  1. NONE

Employment, Commercial Entity:
  1. NONE

Consultancies:
  1. NONE

Speakers' Bureaus:
  1. NONE

Other Activities:
  1. NONE

Clinical Procedures or Imaging Studies:
  1. NONE

Research Support, Commercial Entities:
  1. NONE

Research Support, Government Entities:
  1. NONE

Research Support, Academic Entities:
  1. NONE

Research Support, Foundations and Societies:
  1. NONE

Stock/Stock Options/Board of Directors Compensation:
  1. NONE

License Fee Payments, Technology or Inventions:
  1. NONE

Royalty Payments, Technology or Inventions:
  1. NONE

Stock/Stock Options, Research Sponsor:
  1. NONE

Stock/Stock Options, Medical Equipment & Materials:
  1. NONE

Legal Proceedings:
  1. NONE

Scientific Advisory Boards:
  1. NONE

Gifts:
  1. NONE

Funding for Travel or Speaker Honoraria:
  1. NONE

Editorial Boards:
  1. NONE

Patents:
  1. NONE

Publishing Royalties:
  1. NONE

Employment, Commercial Entity:
  1. NONE

Consultancies:
  1. NONE

Speakers' Bureaus:
  1. NONE

Other Activities:
  1. NONE

Clinical Procedures or Imaging Studies:
  1. NONE

Research Support, Commercial Entities:
  1. NONE

Research Support, Government Entities:
  1. NONE

Research Support, Academic Entities:
  1. NONE

Research Support, Foundations and Societies:
  1. Tosteson and Fund for Medical Discovery Postdoctoral Fellowship Award

Stock/Stock Options/Board of Directors Compensation:
  1. NONE

License Fee Payments, Technology or Inventions:
  1. NONE

Royalty Payments, Technology or Inventions:
  1. NONE

Stock/Stock Options, Research Sponsor:
  1. NONE

Stock/Stock Options, Medical Equipment & Materials:
  1. NONE

Legal Proceedings:
  1. NONE

Scientific Advisory Boards:
  1. NONE

Gifts:
  1. NONE

Funding for Travel or Speaker Honoraria:
  1. NONE

Editorial Boards:
  1. NONE

Patents:
  1. NONE

Publishing Royalties:
  1. NONE

Employment, Commercial Entity:
  1. NONE

Consultancies:
  1. NONE

Speakers' Bureaus:
  1. NONE

Other Activities:
  1. NONE

Clinical Procedures or Imaging Studies:
  1. NONE

Research Support, Commercial Entities:
  1. NONE

Research Support, Government Entities:
  1. NONE

Research Support, Academic Entities:
  1. NONE

Research Support, Foundations and Societies:
  1. NONE

Stock/Stock Options/Board of Directors Compensation:
  1. NONE

License Fee Payments, Technology or Inventions:
  1. NONE

Royalty Payments, Technology or Inventions:
  1. NONE

Stock/Stock Options, Research Sponsor:
  1. NONE

Stock/Stock Options, Medical Equipment & Materials:
  1. NONE

Legal Proceedings:
  1. NONE

Scientific Advisory Boards:
  1. NONE

Gifts:
  1. NONE

Funding for Travel or Speaker Honoraria:
  1. NONE

Editorial Boards:
  1. NONE

Patents:
  1. NONE

Publishing Royalties:
  1. NONE

Employment, Commercial Entity:
  1. NONE

Consultancies:
  1. NONE

Speakers' Bureaus:
  1. NONE

Other Activities:
  1. NONE

Clinical Procedures or Imaging Studies:
  1. NONE

Research Support, Commercial Entities:
  1. NONE

Research Support, Government Entities:
  1. NONE

Research Support, Academic Entities:
  1. NONE

Research Support, Foundations and Societies:
  1. NONE

Stock/Stock Options/Board of Directors Compensation:
  1. NONE

License Fee Payments, Technology or Inventions:
  1. NONE

Royalty Payments, Technology or Inventions:
  1. NONE

Stock/Stock Options, Research Sponsor:
  1. NONE

Stock/Stock Options, Medical Equipment & Materials:
  1. NONE

Legal Proceedings:
  1. NONE

Scientific Advisory Boards:
  1. NONE

Gifts:
  1. NONE

Funding for Travel or Speaker Honoraria:
  1. NONE

Editorial Boards:
  1. NONE

Patents:
  1. NONE

Publishing Royalties:
  1. NONE

Employment, Commercial Entity:
  1. NONE

Consultancies:
  1. NONE

Speakers' Bureaus:
  1. NONE

Other Activities:
  1. NONE

Clinical Procedures or Imaging Studies:
  1. NONE

Research Support, Commercial Entities:
  1. NONE

Research Support, Government Entities:
  1. NONE

Research Support, Academic Entities:
  1. NONE

Research Support, Foundations and Societies:
  1. NONE

Stock/Stock Options/Board of Directors Compensation:
  1. NONE

License Fee Payments, Technology or Inventions:
  1. NONE

Royalty Payments, Technology or Inventions:
  1. NONE

Stock/Stock Options, Research Sponsor:
  1. NONE

Stock/Stock Options, Medical Equipment & Materials:
  1. NONE

Legal Proceedings:
  1. NONE

Scientific Advisory Boards:
  1. NONE

Gifts:
  1. NONE

Funding for Travel or Speaker Honoraria:
  1. NONE

Editorial Boards:
  1. NONE

Patents:
  1. NONE

Publishing Royalties:
  1. NONE

Employment, Commercial Entity:
  1. NONE

Consultancies:
  1. NONE

Speakers' Bureaus:
  1. NONE

Other Activities:
  1. NONE

Clinical Procedures or Imaging Studies:
  1. NONE

Research Support, Commercial Entities:
  1. NONE

Research Support, Government Entities:
  1. NONE

Research Support, Academic Entities:
  1. (1) Medical Research Council (UK), Clinical Research Training Fellowship, 2008-2011 (2) Medical Research Council (UK), Clinician Scientist Fellowship, 2012-

Research Support, Foundations and Societies:
  1. NONE

Stock/Stock Options/Board of Directors Compensation:
  1. NONE

License Fee Payments, Technology or Inventions:
  1. NONE

Royalty Payments, Technology or Inventions:
  1. NONE

Stock/Stock Options, Research Sponsor:
  1. NONE

Stock/Stock Options, Medical Equipment & Materials:
  1. NONE

Legal Proceedings:
  1. NONE

Scientific Advisory Boards:
  1. NONE

Gifts:
  1. NONE

Funding for Travel or Speaker Honoraria:
  1. NONE

Editorial Boards:
  1. NONE

Patents:
  1. NONE

Publishing Royalties:
  1. NONE

Employment, Commercial Entity:
  1. NONE

Consultancies:
  1. NONE

Speakers' Bureaus:
  1. NONE

Other Activities:
  1. NONE

Clinical Procedures or Imaging Studies:
  1. NONE

Research Support, Commercial Entities:
  1. NONE

Research Support, Government Entities:
  1. NONE

Research Support, Academic Entities:
  1. NONE

Research Support, Foundations and Societies:
  1. NONE

Stock/Stock Options/Board of Directors Compensation:
  1. NONE

License Fee Payments, Technology or Inventions:
  1. NONE

Royalty Payments, Technology or Inventions:
  1. NONE

Stock/Stock Options, Research Sponsor:
  1. NONE

Stock/Stock Options, Medical Equipment & Materials:
  1. NONE

Legal Proceedings:
  1. NONE

Scientific Advisory Boards:
  1. NONE

Gifts:
  1. NONE

Funding for Travel or Speaker Honoraria:
  1. NONE

Editorial Boards:
  1. NONE

Patents:
  1. NONE

Publishing Royalties:
  1. NONE

Employment, Commercial Entity:
  1. NONE

Consultancies:
  1. NONE

Speakers' Bureaus:
  1. NONE

Other Activities:
  1. NONE

Clinical Procedures or Imaging Studies:
  1. NONE

Research Support, Commercial Entities:
  1. NONE

Research Support, Government Entities:
  1. NONE

Research Support, Academic Entities:
  1. NONE

Research Support, Foundations and Societies:
  1. NONE

Stock/Stock Options/Board of Directors Compensation:
  1. NONE

License Fee Payments, Technology or Inventions:
  1. NONE

Royalty Payments, Technology or Inventions:
  1. NONE

Stock/Stock Options, Research Sponsor:
  1. NONE

Stock/Stock Options, Medical Equipment & Materials:
  1. NONE

Legal Proceedings:
  1. NONE

Scientific Advisory Boards:
  1. Raze Therapeutics, scientific advisory board

Gifts:
  1. NONE

Funding for Travel or Speaker Honoraria:
  1. NONE

Editorial Boards:
  1. NONE

Patents:
  1. NONE

Publishing Royalties:
  1. NONE

Employment, Commercial Entity:
  1. NONE

Consultancies:
  1. Consultant for Raze Therapeutics, a for-profit biotech company

Speakers' Bureaus:
  1. NONE

Other Activities:
  1. I have given academic talks for which I have received speaker honoraria. These have been for academic colleges, universities, or hospitals.

Clinical Procedures or Imaging Studies:
  1. NONE

Research Support, Commercial Entities:
  1. NONE

Research Support, Government Entities:
  1. National Institutes of Health R24DK080261; Co-Investigator; funded for three years on this renewal grant

Research Support, Academic Entities:
  1. NONE

Research Support, Foundations and Societies:
  1. Howard Hughes Medical Institute

Stock/Stock Options/Board of Directors Compensation:
  1. NONE

License Fee Payments, Technology or Inventions:
  1. NONE

Royalty Payments, Technology or Inventions:
  1. NONE

Stock/Stock Options, Research Sponsor:
  1. NONE

Stock/Stock Options, Medical Equipment & Materials:
  1. NONE

Legal Proceedings:
  1. NONE

Scientific Advisory Boards:
  1. NONE

Gifts:
  1. NONE

Funding for Travel or Speaker Honoraria:
  1. NONE

Editorial Boards:
  1. BRAIN, Associate Editor 2004

Patents:
  1. NONE

Publishing Royalties:
  1. NONE

Employment, Commercial Entity:
  1. NONE

Consultancies:
  1. NONE

Speakers' Bureaus:
  1. NONE

Other Activities:
  1. NONE

Clinical Procedures or Imaging Studies:
  1. NONE

Research Support, Commercial Entities:
  1. NONE

Research Support, Government Entities:
  1. Medical Research Council (UK)

Research Support, Academic Entities:
  1. NONE

Research Support, Foundations and Societies:
  1. Wellcome Trust

Stock/Stock Options/Board of Directors Compensation:
  1. NONE

License Fee Payments, Technology or Inventions:
  1. NONE

Royalty Payments, Technology or Inventions:
  1. NONE

Stock/Stock Options, Research Sponsor:
  1. NONE

Stock/Stock Options, Medical Equipment & Materials:
  1. NONE

Legal Proceedings:
  1. NONE

Abstract

Objective: To define the mechanism responsible for fatigue, lethargy, and weakness in 2 cousins who had a normal muscle biopsy.

Methods: Exome sequencing, long-range PCR, and Sanger sequencing to identify the pathogenic mutation. Functional analysis in the patient fibroblasts included oxygen consumption measurements, extracellular acidification studies, Western blotting, and calcium imaging, followed by overexpression of the wild-type protein.

Results: Analysis of the exome sequencing depth revealed a homozygous deletion of exon 1 of MICU1 within a 2,755-base pair deletion. No MICU1 protein was detected in patient fibroblasts, which had impaired mitochondrial calcium uptake that was rescued through the overexpression of the wild-type allele.

Conclusions: MICU1 mutations cause fatigue and lethargy in patients with normal mitochondrial enzyme activities in muscle. The fluctuating clinical course is likely mediated through the mitochondrial calcium uniporter, which is regulated by MICU1.

GLOSSARY

CK=
creatine kinase;
GATK=
Genome Analysis Toolkit;
MAF=
minor allele frequency;
PDH=
pyruvate dehydrogenase;
SNVs=
single nucleotide variants

Mitochondrial disorders can present with a multisystem neuromuscular disorder or can affect only one organ system, such as skeletal muscle, where fatigue and subjective muscle weakness may be the only symptoms. Although molecular genetic testing can reveal the diagnosis in some patients, clinical evaluation often involves a muscle biopsy followed by the biochemical analysis of mitochondrial respiratory chain enzymes. Here we describe 2 cousins with normal mitochondrial electron transport chain enzyme activities who had a homozygous deletion of exon 1 of MICU1 that was detected by analyzing the depth of exome sequence coverage. Functional studies revealed a defect of mitochondrial calcium handling, providing an explanation for their fluctuating clinical course.

METHODS

Patients.

A 9-year-old girl was referred in 2011 with 4 years of episodic fatigue and lethargy causing frequent school absences. The third child of healthy parents, her in utero and psychomotor development was normal (figure 1). Initially the episodes accompanied minor viral infections and evolved over hours. She would become pale and sweaty and then lethargic and sleepy. At times she was unable to stand unaided and became noncommunicative and unrousable. Now she is 13 years of age and the episodes are precipitated by minimal exercise, such as running down the road. Avoiding physical activity has reduced the frequency of the “attacks,” but after 100 m of walking she now develops muscle aches that limit her activities and resolve after 15 minutes of rest. She is in the 2nd percentile for weight and the 9th percentile for height; her muscles are thin but strong between the episodes. There are no neurologic or ophthalmologic signs. The nonspecific episodes were not investigated until her serum creatine kinase (CK) was measured (497 IU/L between attacks and 2,067 IU/L during attacks). Other blood tests, including lactate, urine organic and amino acids, and acylcarnitines, were normal.

Figure 1
Figure 1 Pedigree of the family described in the case report

IV:3 is the index case and IV:6 is her cousin. DNA was available for family members indicated with an asterisk, allowing the segregation analysis shown in figure 2. The 2 gray-shaded individuals have not been assessed in the United Kingdom: 1 failed to walk and died in infancy and the other is reported to have muscle problems.

Her cousin described similar episodes on a more complex background. After a normal pregnancy and birth, delayed development was noted at 6 months when nystagmus and an abnormal red reflex revealed cataracts. In early childhood he had episodes of clumsiness with falls associated with intercurrent illness accompanied by headaches and vomiting. Now 12 years of age, he has frequent classic migraines and develops muscle aches after 15 minutes of light exercise. This is associated with intense lethargy, poor concentration, and occasional confusion, which resolve spontaneously within hours or days. Decreasing physical activity to a bare minimum has reduced the frequency of the attacks. He is in the 50th percentile for height and weight and has low-set big ears, a prominent chin, and long thin fingers. He has mild learning difficulties, pendular nystagmus, bilateral optic atrophy, mild hypotonia, and global muscle weakness leading to a positive Gower maneuver. Normal blood tests included glucose and lactate levels between and during the attacks, urine organic and amino acids, and acylcarnitine profile. CK levels >2,000 IU/L have been noted. ECG, echocardiography, and brain MRI were normal. Muscle biopsy revealed rare atrophic fibers, increased internal nuclei, normal mitochondrial respiratory chain complex activities, normal mitochondrial DNA levels, and normal electron microscopy. The karyotype and array comparative genomic hybridization were normal.

Molecular genetics.

Blood genomic DNA was fragmented from both affected cousins (IV:3 and IV:6), exome-enriched, and sequenced (Illumina TruSeq 62 Mb exome capture and HiSeq 2000, 100 bp paired-end reads). In-house bioinformatic analysis included alignment to UCSC hg19 and using Burrows-Wheeler Aligner and Genome Analysis Toolkit (GATK) to detect single nucleotide variants (SNVs) and small insertion/deletions across all samples using standard filtering parameters according to GATK Best Practice Recommendations.1 We sought rare, predicted protein-altering homozygous and compound heterozygous variants that were shared between the 2 affected cousins with minor allele frequency (MAF) <0.005 in the ExAC and NHLBI-ESP6500 databases, MAF <0.02 in the CG69 database, and MAF <0.01 in 337 unrelated in-house controls.2,–,4 Copy number variant analysis was performed using ExomeDepth.5 Multiple primer pairs were designed to define the deletion breakpoint using long-range PCR (LA-Taq). Sanger sequencing was used to define the breakpoint. Breakpoint-specific primers were used to track the deletion in the family.

Cell biochemistry.

Primary skin fibroblasts were derived from both patients (IV:3 and IV:6) and a heterozygous relative (III:3). Oxygen consumption, extracellular acidification studies, Western blotting, and calcium imaging were performed as described.6,–,8

Standard protocol approvals, registrations, and patient consents.

This study had national ethical review board approval and local institutional approval. Informed consent was provided by the participating families.

RESULTS

No plausible pathogenic SNVs were identified in the exome sequence (table e-1 at Neurology.org/ng). Analysis of exome coverage revealed a likely homozygous partial deletion of MICU1 (figure 2A), which was mapped by long-range PCR (figure 2, B and C). Sanger sequencing defined the breakpoint (Chr 10: 74,385,085-74,387,860, figure 2D) and the size of the deletion (2,775 nucleotide pairs). Breakpoint primers were used to track the MICU1 deletion in family members (figure 2E), which showed complete segregation with the disorder. Fibroblasts from patients respired normally, showing oxygen consumption and extracellular acidification rates similar to the heterozygous fibroblasts (figure 3, A and B). MICU1 protein was not detectable by immunoblot in the patient fibroblasts, but mitochondrial Ca(2+) uniporter protein levels were normal (figure 3C). The cells lacking MICU1 showed impaired mitochondrial calcium uptake, which was rescued by introducing exogenous MICU1 but not a control mitochondrial-targeted green fluorescent protein (figure 3, D and E).

Figure 2
Figure 2 Identification of the deletion

(A) Exome read depth across MICU1 for the 2 patients (IV:3 = patient 1, red; IV:6 = patient 2, yellow) and a representative control (blue) showing a likely homozygous deletion involving exon 1 in IV:3 and IV:6. (B) Long-range PCR primer walking demonstrated the limits of the deletion within the region identified through analysis of exome sequencing coverage (oligonucleotide primers shown as red and green bars). PCR amplification using the named primer pairs shows absence of a product with combination 74,387,000. − = no DNA control, + = healthy control. (C) Long-range PCR using the forward primer from pair 74,384,500 and the reverse primer from pair 74,388,250 amplified a ∼1-kb fragment from the 2 affected cousins, which was small enough for Sanger sequencing. Primers: Fwd TTCCCTTTCTCCTCAGGCAC, Rev GTCTACCGGATTCAGGCGAT. When compared with control DNA, this equated to a ∼2.7-kb homozygous deletion in the patients. (D) Sanger sequence from the 2 affected cousins (IV:3 and IV:6) showing the homozygous deletion breakpoint. Primers: Fwd TTCCCTTTCTCCTCAGGCAC, Rev GTCTACCGGATTCAGGCGAT. (E) Segregation analysis of the MICU1 deletion. PCR spanning the breakpoint showing the homozygous deletion in the 2 affected cousins (IV:3 and IV:6) and a heterozygous deletion in other family members (III:2, III:3, III:4, III:5, and IV:2). Primers: Fwd CCTGGGCGACAAGTGTAAAA Position Chr 10:74,381,222; Rev CCCAGGCATTTGATCACCAG Position Chr 10:74,390,095. Amplification of the mutant allele in heterozygous carriers of the MICU1 deletion produced an additional intermediate band of ∼8 kb that is unexplained but did not affect the segregation analysis. Other symbols refer to the pedigree shown in figure 1. WT = wild type.

Figure 3
Figure 3 Loss of MICU1 leads to a deficit in mitochondrial calcium handling without impairing respiration

(A) Oxygen consumption rates (OCR) and (B) extracellular acidification rates (ECAR) of MICU1+/− and MICU1−/− fibroblasts were measured by Seahorse XF analysis. Mean values ± SE (error bars) from 3 independent experiments are shown (differences are not statistically significant). (C) Immunoblot of whole cell lysates from MICU1+/− and MICU1−/− fibroblasts. (D) Digitonin-permeabilized fibroblasts were given a pulse of 35 μM CaCl2 while monitoring extramitochondrial Ca2+ with calcium green-5N.8 (E) Quantification of the rate of calcium uptake from calcium uptake traces including those in D (using linear fit from 30 to 40 seconds). Mean values ± SD (error bars) from 3 independent experiments are shown. (F) MICU1+/− (+) and MICU1−/− (−) fibroblasts were exposed to different conditions (untreated, 500 nM CCCP, 1 μM oligomycin, or serum starvation) and pyruvate dehydrogenase (PDH) and phosphorylated PDH (at S293) were measured by immunoblot after lysing the cells in 1% Triton-X-100, 150 mM NaCl, 25 mM Hepes pH 7.4, and protease and phosphatase inhibitors. (G) Quantification of 3 independent experiments including the representative experiment in F are shown. Mean values ± SE (error bars). MCU = mitochondrial Ca2+ uniporter; SDHB = succinate dehydrogenase subunit B.

DISCUSSION

The homozygous MICU1 deletion is highly likely to be responsible for the disorder affecting the 2 cousins because (1) the mutation has not been described before in large control exome databases; (2) it showed complete segregation with the phenotype in the family; (3) as predicted, there was no detectable level of MICU1 protein in the patient fibroblasts; and (4) this caused an anticipated defect of mitochondrial calcium handling, which was rescued by expressing the wild-type protein.

The calcium uptake rate difference, which is reminiscent of Micu1 knockdown in mouse liver mitochondria,9 has 2 possible explanations. MICU1 has been proposed to be an activator of the uniporter, in which case removing it could result in reduced calcium uptake rate.7,10 Alternatively, MICU1 has also been proposed to be a gatekeeper of the uniporter that prevents baseline levels of cytosolic calcium from entering into mitochondria.6,–,8 In this case, the observed lower calcium uptake rate may actually represent a secondary consequence of increased basal matrix calcium in the absence of MICU1, which would reduce the driving force for calcium uptake. This is consistent with what has previously been reported in skin fibroblasts from patients lacking MICU1.11 Consistent with the latter model in which cells have higher basal matrix calcium, the levels of phosphorylation of pyruvate dehydrogenase (PDH) at S293 are higher in the homozygous fibroblasts (figure 3, F and G). The PDH phosphatase is activated by matrix calcium, leading to dephosphorylated (activated) PDH. Thus, decreased PDH phosphorylation would be consistent with increased matrix calcium levels. As expected, both CCCP and oligomycin reduced PDH phosphorylation, whereas serum starvation resulted in increased PDH phosphorylation, showing that the assay could detect both increases and decreases in PDH phosphorylation.12

Numerous hurdles obscured the diagnosis in this family. For several years the nonspecific clinical course precluded specialist referral. Further investigation followed a detailed family history and the CK measurement. This combination of fluctuating fatigue, migraine with obtundation, and a high CK level raised the possibility of a mitochondrial disorder, but conventional respiratory chain studies were normal. The diagnosis became apparent only by analyzing the exome sequence read depth. Based on the limited clinical descriptions published to date, our patients have a similar phenotype to patients with MICU1 substitutions, although cataracts have not been noted before (table e-1, reference 11).

The extreme clinical fluctuation described here is reminiscent of an ion channelopathy. The likely role of MICU1 as a calcium-sensing regulator of the mitochondrial calcium uniporter7,13 provides an explanation for the fluctuating clinical course seen in patients with MICU1 and raises the hypothesis that calcium channel blockers may alter the disease course.

AUTHOR CONTRIBUTIONS

Dr. Lewis-Smith: acquisition of data, analysis, interpretation, critical revision of the manuscript for important intellectual content. Ms. Kamer: acquisition of data, analysis, interpretation, critical revision of the manuscript for important intellectual content. Dr. Griffin: analysis, interpretation, critical revision of the manuscript for important intellectual content. Dr. Childs: acquisition of data and interpretation. Dr. Pysden: acquisition of data and interpretation. Dr. Titov: acquisition of data and interpretation. Dr. Duff: acquisition of data and interpretation. Dr. Pyle: acquisition of data and interpretation. Dr. Taylor: acquisition of data, interpretation, critical revision of the manuscript for important intellectual content. Dr. Yu-Wai-Man: acquisition of data, interpretation, critical revision of the manuscript for important intellectual content. Dr. Ramesh: acquisition of data and interpretation. Dr. Horvath: acquisition of data, analysis, interpretation, study supervision, critical revision of the manuscript for important intellectual content. Dr. Mootha: study concept and design, acquisition of data, analysis, interpretation, study supervision, critical revision of the manuscript for important intellectual content. Dr. Chinnery: study concept and design, acquisition of data, analysis, interpretation, study supervision, wrote the first draft manuscript.

STUDY FUNDING

Wellcome Trust (101876/Z/13/Z, 096919Z/11/Z), Medical Research Council (UK) (G0601943), and Medical Research Council Mitochondrial Biology Unit (MC_UP_1501/2).

DISCLOSURE

Dr. Lewis-Smith reports no disclosures. Ms. Kamer has received research support from the National Science Foundation. Drs. Griffin, Childs, and Psyden, report no disclosures. Dr. Titov has received research support from Tosteson and Fund for Medical Discovery. Drs. Duff, Pyle, and Taylor report no disclosures. Dr. Yu-Wai-Man has received research support from the Medical Research Council. Drs. Ramesh and Horvath report no disclosures. Dr. Mootha has served on the scientific advisory board of Raze Therapeutics; has been a consultant for Raze Therapeutics; has received speaker honoraria from academic colleges, universities, and hospitals; and has received research support from the NIH and the Howard Hughes Medical Institute. Dr. Chinnery has served on the editorial board of Brain and has received research support from the Medical Research Council and Wellcome Trust. Go to Neurology.org/ng for full disclosure forms.

ACKNOWLEDGMENT

P.F.C. is a Wellcome Trust Senior Fellow in Clinical Science (101876/Z/13/Z) and a UK NIHR Senior Investigator who receives support from the Medical Research Council Mitochondrial Biology Unit (MC_UP_1501/2), the Wellcome Trust Centre for Mitochondrial Research (096919Z/11/Z), the Medical Research Council (UK) Centre for Translational Muscle Disease research (G0601943), EU FP7 TIRCON, and the National Institute for Health Research (NIHR) Biomedical Research Centre based at Cambridge University Hospitals NHS Foundation Trust and the University of Cambridge. R.W.T. is funded by the Wellcome Trust Centre for Mitochondrial Research (096919Z/11/Z), the Medical Research Council (UK) Centre for Translational Muscle Disease research (G0601943), the Lily Foundation, and the UK NHS Highly Specialised “Rare Mitochondrial Disorders of Adults and Children” Service in Newcastle upon Tyne. P.Y.-W.-M. is a Medical Research Council (MRC, UK) Clinician Scientist (G1002570). P.Y.-W.-M. also receives funding from Fight for Sight (UK) and the UK National Institute of Health Research (NIHR) as part of the Rare Diseases Translational Research Collaboration. V.K.M. is an Investigator of the Howard Hughes Medical Institute. The views expressed are those of the author(s) and not necessarily those of the NHS, the NIHR, or the Department of Health.

Footnotes

  • ↵* These authors contributed equally to this study.

  • Funding information and disclosures are provided at the end of the article. Go to Neurology.org/ng for full disclosure forms. The Article Processing Charge was paid by the authors.

  • Supplemental data at Neurology.org/ng

  • Received October 19, 2015.
  • Accepted in final form January 8, 2016.
  • © 2016 American Academy of Neurology

This is an open access article distributed under the terms of the Creative Commons Attribution License 4.0 (CC BY), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

REFERENCES

  1. 1.↵
    1. Van der Auwera GA,
    2. Carneiro MO,
    3. Hartl C,
    4. et al
    . From FastQ data to high-confidence variant calls: the Genome Analysis Toolkit best practices pipeline. Curr Protoc Bioinformatics 2013;15:11.10.1–11.0.33.
    OpenUrl
  2. 2.↵
    Available at: http://exac.broadinstitute.org. Accessed July 31, 2015.
  3. 3.↵
    Available at: http://evs.gs.washington.edu/EVS/. Accessed July 31, 2015.
  4. 4.↵
    Available at: http://www.completegenomics.com/public-data/69-genomes/. Accessed July 31, 2015.
  5. 5.↵
    1. Plagnol V,
    2. Curtis J,
    3. Epstein M,
    4. et al
    . A robust model for read count data in exome sequencing experiments and implications for copy number variant calling. Bioinformatics 2012;28:2747–2754.
    OpenUrlAbstract/FREE Full Text
  6. 6.↵
    1. Mallilankaraman K,
    2. Doonan P,
    3. Cardenas C,
    4. et al
    . MICU1 is an essential gatekeeper for MCU-mediated mitochondrial Ca(2+) uptake that regulates cell survival. Cell 2012;151:630–644.
    OpenUrlCrossRefPubMedWeb of Science
  7. 7.↵
    1. Csordas G,
    2. Golenar T,
    3. Seifert EL,
    4. et al
    . MICU1 controls both the threshold and cooperative activation of the mitochondrial Ca2+ uniporter. Cell Metab 2013;17:976–987.
    OpenUrlCrossRefPubMedWeb of Science
  8. 8.↵
    1. Kamer KJ,
    2. Mootha VK
    . MICU1 and MICU2 play nonredundant roles in the regulation of the mitochondrial calcium uniporter. EMBO Rep 2014;15:299–307.
    OpenUrlAbstract/FREE Full Text
  9. 9.↵
    1. Plovanich M,
    2. Bogorad RL,
    3. Sancak Y,
    4. et al
    . MICU2, a paralog of MICU1, resides within the mitochondrial uniporter complex to regulate calcium handling. PLoS One 2013;8:e55785.
    OpenUrlCrossRefPubMed
  10. 10.↵
    1. Patron M,
    2. Checchetto V,
    3. Raffaello A,
    4. et al
    . MICU1 and MICU2 finely tune the mitochondrial Ca2+ uniporter by exerting opposite effects on MCU activity. Mol Cell 2014;53:726–737.
    OpenUrlCrossRefPubMedWeb of Science
  11. 11.↵
    1. Logan CV,
    2. Szabadkai G,
    3. Sharpe JA,
    4. et al
    . Loss-of-function mutations in MICU1 cause a brain and muscle disorder linked to primary alterations in mitochondrial calcium signaling. Nat Genet 2013;46:188–193.
    OpenUrl
  12. 12.↵
    1. Rardin MJ,
    2. Wiley SE,
    3. Naviaux RK,
    4. Murphy AN,
    5. Dixon JE
    . Monitoring phosphorylation of the pyruvate dehydrogenase complex. Anal Biochem 2009;389:157–164.
    OpenUrlCrossRefPubMedWeb of Science
  13. 13.↵
    1. Perocchi F,
    2. Gohil VM,
    3. Girgis HS,
    4. et al
    . MICU1 encodes a mitochondrial EF hand protein required for Ca(2+) uptake. Nature 2010;467:291–296.
    OpenUrlCrossRefPubMedWeb of Science

Letters: Rapid online correspondence

No comments have been published for this article.
Comment

REQUIREMENTS

If you are uploading a letter concerning an article:
You must have updated your disclosures within six months: http://submit.neurology.org

Your co-authors must send a completed Publishing Agreement Form to Neurology Staff (not necessary for the lead/corresponding author as the form below will suffice) before you upload your comment.

If you are responding to a comment that was written about an article you originally authored:
You (and co-authors) do not need to fill out forms or check disclosures as author forms are still valid
and apply to letter.

Submission specifications:

  • Submissions must be < 200 words with < 5 references. Reference 1 must be the article on which you are commenting.
  • Submissions should not have more than 5 authors. (Exception: original author replies can include all original authors of the article)
  • Submit only on articles published within 6 months of issue date.
  • Do not be redundant. Read any comments already posted on the article prior to submission.
  • Submitted comments are subject to editing and editor review prior to posting.

More guidelines and information on Disputes & Debates

Compose Comment

More information about text formats

Plain text

  • No HTML tags allowed.
  • Web page addresses and e-mail addresses turn into links automatically.
  • Lines and paragraphs break automatically.
Author Information
NOTE: The first author must also be the corresponding author of the comment.
First or given name, e.g. 'Peter'.
Your last, or family, name, e.g. 'MacMoody'.
Your email address, e.g. higgs-boson@gmail.com
Your role and/or occupation, e.g. 'Orthopedic Surgeon'.
Your organization or institution (if applicable), e.g. 'Royal Free Hospital'.
Publishing Agreement
NOTE: All authors, besides the first/corresponding author, must complete a separate Publishing Agreement Form and provide via email to the editorial office before comments can be posted.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.

Vertical Tabs

You May Also be Interested in

Back to top
  • Article
    • Abstract
    • GLOSSARY
    • METHODS
    • RESULTS
    • DISCUSSION
    • AUTHOR CONTRIBUTIONS
    • STUDY FUNDING
    • DISCLOSURE
    • ACKNOWLEDGMENT
    • Footnotes
    • REFERENCES
  • Figures & Data
  • Info & Disclosures
Advertisement

Preferences and User Experiences of Wearable Devices in Epilepsy A Systematic Review and Mixed-Methods Synthesis

Dr. Daniel Friedman and Dr. Sharon Chiang

► Watch

Topics Discussed

  • All Neuromuscular Disease

Alert Me

  • Alert me when eletters are published
Neurology Genetics: 9 (2)

Articles

  • Articles
  • Issues
  • Popular Articles

About

  • About the Journals
  • Ethics Policies
  • Editors & Editorial Board
  • Contact Us
  • Advertise

Submit

  • Author Center
  • Submit a Manuscript
  • Information for Reviewers
  • AAN Guidelines
  • Permissions

Subscribers

  • Subscribe
  • Sign up for eAlerts
  • RSS Feed
Site Logo
  • Visit neurology Template on Facebook
  • Follow neurology Template on Twitter
  • Visit Neurology on YouTube
  • Neurology
  • Neurology: Clinical Practice
  • Neurology: Education
  • Neurology: Genetics
  • Neurology: Neuroimmunology & Neuroinflammation
  • AAN.com
  • AANnews
  • Continuum
  • Brain & Life
  • Neurology Today

Wolters Kluwer Logo

Neurology: Genetics | Online ISSN: 2376-7839

© 2023 American Academy of Neurology

  • Privacy Policy
  • Feedback
  • Advertise